After fulfilling the ideal of manifest destiny and expanding its territory to the Pacific Ocean, the United States shifted from a policy of isolationism to imperialism primarily to find new markets to sell goods and acquire raw materials (option A).
This shift was driven by a need to fuel the growing American economy and maintain its competitive edge on the global stage.
As the United States industrialized, it needed access to new resources and markets for its manufactured goods. Expanding its global influence allowed the country to secure these resources and markets, helping it become a significant player in international trade.
Additionally, the United States wanted to compete with European nations (option D), who were also establishing colonies around the world. By engaging in imperialism, the U.S. could assert its power and influence on a global scale, aligning with the idea of American exceptionalism.
While options B and C may have been secondary motivations, they were not the primary reasons for the shift from isolationism to imperialism. Acquiring new territory to relieve overcrowding in cities (option B) and discovering new technology to improve industrial efficiency (option C) were not the main driving forces behind this policy change.
In summary, the United States shifted from isolationism to imperialism to find new markets to sell goods and acquire raw materials, as well as to compete with European nations by establishing colonies and expanding its global influence.
To know more about imperialism refer here
https://brainly.com/question/30210572#
#SPJ11
What Alamo hero died beside the cannon at the back of the Alamo church?
How did the League of Nations respond to Japan's annex of Manchuria in 1931? What did Japan do?
Japan violated the League of Nations in 1931 when it invaded Manchuria.
The League's chief weapon, economic sanctions, was ineffective.
Japan, ruled by a reactionary Emperor under the influence of generals with expansionist ambitions, simply ignored the League's demand that it leave China and instead withdrew from the League.
Poor U.S. households today are more likely to own a refrigerator, air-conditioner, and dishwasher than the ____ household was in 1970.
Poor U.S. households today are more likely to own a refrigerator, air-conditioner, and dishwasher than the average household was in 1970.
This is due to several factors including advances in technology, changes in consumer behavior, and government programs aimed at improving living conditions for low-income families. In the past few decades, appliances have become more affordable and energy-efficient, making them more accessible to lower-income households.
Additionally, changes in consumer behavior have led to a greater emphasis on home ownership and home improvement, which has resulted in more households investing in appliances that can improve their quality of life.
Finally, government programs like the Low-Income Home Energy Assistance Program (LIHEAP) and the Weatherization Assistance Program (WAP) have provided funding and resources for low-income households to upgrade their homes and appliances.
Overall, while poverty remains a major issue in the United States, the increasing availability of modern appliances has helped to improve the quality of life for many low-income households.
To know more about household, refer here:
https://brainly.com/question/30713586#
#SPJ11
The concept of the ready made was introduced byA. Edward HopperB. Constantin BrancusiC. Louise NevelsonD. Marcel Duchamp
The concept of the ready-made was introduced by Marcel Duchamp, a French artist who challenged the traditional notion of art in the early 20th century. The correct option is D
Duchamp's ready-mades were everyday objects that he selected and presented as art. The idea was to question the role of the artist in the creation of art and to challenge the value and meaning of art objects. Duchamp's most famous ready-made was a porcelain urinal that he signed with a pseudonym and titled "Fountain".
The piece sparked controversy and challenged the art world's conventional ideas about what constitutes art. The ready-made concept has since influenced and inspired many artists, including Louise Nevelson, who incorporated found objects into her sculptures.
Constantin Brancusi, a Romanian sculptor, also experimented with the ready-made concept in his own way by using natural materials such as stone and wood to create abstract forms.
To know more about Marcel Duchamp refer here:
https://brainly.com/question/10549260#
#SPJ11
What changes did Rabbani and his jurisdiction implement?
Rabbani and his jurisdiction implemented a number of changes during his time as President of Afghanistan from 1992-1996. One of the most significant changes was the implementation of Islamic law, or sharia, as the basis for the country's legal system.
This included the establishment of Islamic courts and the imposition of strict punishments for crimes such as theft and adultery. Rabbani also made efforts to modernize the country's infrastructure, including the construction of roads and schools.
He also worked to establish diplomatic relations with other countries, including Pakistan and Saudi Arabia. However, Rabbani's rule was marked by ongoing conflict and instability, as various factions vied for power and control over the country.
In 1996, the Taliban overthrew Rabbani's government and established their own regime based on a strict interpretation of Islamic law.
To know more about Afghanistan refer here:
https://brainly.com/question/12545768#
#SPJ11
When Riis cited the example of Miss Ellen Collins and improvements to the water street houses, did her advocate that the best solution was through charity or private enterprise?
When citing the example of Miss Ellen Collins and improvements to the Water Street houses, Jacob Riis advocated for a solution involving private enterprise rather than charity. Collins believed in encouraging private enterprise to build better housing, which was a contrast to many other social reformers who advocated for government intervention and charity.
When Jacob Riis cited the example of Miss Ellen Collins and improvements to the Water Street houses, he advocated for a solution that involved private enterprise rather than charity.
Miss Collins was a social reformer who worked with landlords and builders to improve living conditions for the urban poor. Rather than relying on charity or government intervention, she believed that the best way to improve the lives of the poor was to encourage private enterprise to build better housing.
She worked with builders to create model tenements that were clean, well-ventilated, and affordable. This approach was in contrast to many of the other social reformers of the time, who advocated for government intervention and charity as the best ways to address poverty and housing issues.
To know more about Jacob Riis:
https://brainly.com/question/9117
#SPJ4
THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA?
The nucleotide sequence that would be translated from this strand of DNA is ATCGCTTAGAACCGCATTCTT.
Nucleotide sequence is a string of nucleotides, which are the basic units of genes and genetic information. Nucleotides are made up of three parts: a phosphate group, a sugar molecule (deoxyribose), and a nitrogenous base.
The nitrogenous bases come in four different types—adenine (A), guanine (G), cytosine (C), and thymine (T). Every gene consists of an ordered sequence of these four bases. Different sequences of these compositions determine the physical characteristics expressed by an organism.
To know more about nucleotide sequence visit:
https://brainly.com/question/17105264
#SPJ4
Why is Tony Taylor upset at Lige Moss during the party celebrating the store's grand opening?
Tony Taylor is mad because Lige Moss interrupts "the one speech of his lifetime," which was being made to welcome the Starks couple to Eatonville.
Their Eyes Was on God is a 1937 novel by American author Zora Neale Hurston. It is considered a classic of the Harlem Renaissance and is Heston's most famous work. The novel explores the transformation of Jenny Crawford's protagonist "from a young but quiet woman to a woman who touches her own destiny". The response in south-central Florida in the early 20th century was initially negative. However, it is thought to have influenced African-American literature and women's literature since the end of the 20th century.
To know more about Harlem Renaissance click on the link below.
https://brainly.com/question/9195022
#SPJ4
How did King John's actions affect the creation of the Magna Carta
A. his failures led the barons to demand limitations of his power
B. his arguing with the nobles lead the barons to remove him from power
C. his treatment of the nobles lead the barons to demand the separation of the government branches
D. his victory in the war led the barons to sign a peace treaty explaining their rights
Answer:
A. King John's failures led the barons to demand limitations of his power, which ultimately led to the creation of the Magna Carta.
Explanation:
trust
Which Egyptian Royalty commissioned a Mortuary Temple Designed by Senmut?
The temple was commissioned by Hatshepsut. Its building was probably overseen by Senenmut, her trusted advisor who some researchers speculate may have also been her lover.
A mortuary temple constructed during the rule of Pharaoh Hatshepsut of Egypt's Eighteenth Dynasty is known as the Hatshepsut funerary temple. It is regarded as a marvel of ancient architecture and is situated across from the city of Luxor.
The whole construction pointed in the direction of the imposing Eighth Pylon, which Hatshepsut added to the Temple of Karnak as her most known work and from which the procession of participants of the Beautiful Festival of the Valley departed.
Learn more about Mortuary Temple here:
https://brainly.com/question/31182497
#SPJ4
Economists call the constant ____ of the economy "creative destruction"
Economists refer to the constant transformation of the economy as creative destruction.
This concept was first introduced by Austrian economist Joseph Schumpeter in 1942. Creative destruction refers to the process through which innovative and technologically advanced ideas, products, and processes replace outdated ones, leading to economic growth and development.
In the context of the economy, creative destruction occurs when new technologies, products, or methods of production are introduced, making older ones obsolete. This process can result in the disappearance of certain industries or companies while creating new ones in their place.
Despite the potential negative impact on specific sectors or businesses, creative destruction is considered an essential driver of long-term economic growth and improved standards of living.
1. Innovation and technological advancements are introduced in the market.
2. These advancements lead to increased efficiency and productivity.
3. As a result, older technologies, products, or methods of production become obsolete and less competitive.
4. Companies and industries using the outdated technologies either adapt to the changes or face decline and potential closure.
5. New industries and companies emerge in response to the new technologies and market demands.
6. The process continues, constantly reshaping the economy and driving economic growth.
In conclusion, creative destruction is a vital aspect of a dynamic and evolving economy, ensuring continuous progress and development through the constant transformation of industries, products, and processes.
To know more about creative destruction, refer here:
https://brainly.com/question/28188575#
#SPJ11
What can you tell me about the context and the style of Repos d'amour?
"Repos d'amour" is a painting by the French Rococo artist Jean-Honoré Fragonard, created around 1771-1773. The painting depicts a young couple resting in a landscape, surrounded by lush vegetation and flowers.
In terms of style, "Repos d'amour" is a quintessential example of the Rococo style. Rococo is characterized by its ornate and playful decorations, as well as its light and delicate brushwork.
The style emerged in France in the early 18th century, and was associated with the French court and aristocracy.
"Repos d'amour" is notable for its use of pastel colors and soft brushwork, which create a dreamy and romantic atmosphere.
The landscape is depicted in a hazy and almost abstract manner, with the emphasis placed on the couple in the foreground.
The woman is shown lying on her back, with her head resting on her lover's lap, while he leans over her and gazes down at her.
In terms of context, "Repos d'amour" was created during a time of great political and social upheaval in France. The painting was created just a few years before the French Revolution, which would overthrow the French monarchy and transform French society.
The Rococo style, which had been associated with the French court and aristocracy, would fall out of favor during the Revolution, as the new regime favored a more austere and classical style.
Despite this, "Repos d'amour" remains a beloved example of the Rococo style, and continues to be admired for its beauty and charm.
to know more about French Rococo refer here:
https://brainly.com/question/28260986#
#SPJ11
why did violence flare up in the hudson river valley during the 1750s and 1760s? group of answer choices tenants challenged elite landlords over evictions. native americans burned settler homes over land issues. african american slaves confiscated white-owned plantations. the spanish royal government sent troops against british colonial tax evaders.
The reason violence flared up in the Hudson River Valley during the 1750s and 1760s was mainly due to tenants challenging elite landlords over evictions and Native Americans burning settler homes over land issues.
In the mid-18th century, tensions arose between tenant farmers and elite landlords in the Hudson River Valley. Landlords often held large tracts of land and leased them to tenant farmers, who were subject to high rents and strict contracts.
Many tenants felt exploited and began to challenge the landlords over evictions, leading to violence and unrest.
At the same time, Native Americans in the region were increasingly resentful of the continued expansion of European settlers into their territories.
As settlers encroached on Native American lands, tensions grew, and Native Americans began to burn settler homes in retaliation for land disputes. This contributed to the overall atmosphere of violence and conflict during this period.
The other options mentioned, such as African-American slaves confiscating white-owned plantations and the Spanish royal government sending troops against British colonial tax evaders, were not the primary causes of the violence in the Hudson River Valley during the 1750s and 1760s.
To know more about refer Hudson River Valley here
brainly.com/question/14035135#
#SPJ11
TRUE OR FALSE 86) Colonialism is an effort by one country to establish settlements and impose its political, economic, and cultural principles on an alien people.
The given statement "colonialism is an effort by one country to establish settlements and impose its political, economic, and cultural principles on an alien people" is true, because it results in the loss of native culture and political autonomy, while benefiting the colonization of country economically.
This practice has been historically prevalent, with countries expanding their territories by establishing colonies in other regions. The colonizing country often seeks to exploit the resources of the colonized region, while also imposing their political system, economic structure, and cultural values upon the local population.
Colonialism often involves the suppression of the native culture and the promotion of the colonizer's culture. This can result in significant changes to the social and political structures of the colonized society.
The colonizing country typically benefits economically from the exploitation of resources and labor, while the colonized people may face long-term disadvantages due to the loss of sovereignty and self-determination.
In summary, the statement is true: colonialism is the process by which one country seeks to establish settlements in another region and impose its political, economic, and cultural principles on the native people.
This practice has had profound and lasting effects on the societies involved, often resulting in the loss of native culture and political autonomy, while benefiting the colonization of country economically.
To know more about colonization, refer here:
https://brainly.com/question/30764395#
#SPJ11
how did the status of wealthy roman women differ from that of most greek women in the classical age?
The status of wealthy Roman women differed from that of most Greek women in the Classical Age in several ways i.e., wealthy families, social mobility, education and marriage.
Firstly, Roman women, particularly those from wealthy families, enjoyed a greater degree of legal and economic independence compared to their Greek counterparts.
Roman women could own and manage property, initiate divorce, and engage in business transactions, whereas Greek women generally could not.
Secondly, wealthy Roman women were often more involved in public life and had greater social mobility.
They could attend public events, such as theater performances and religious ceremonies, and even had some influence in political matters, albeit indirectly.
In contrast, Greek women, particularly those in Athens, were primarily restricted to the domestic sphere and had limited participation in public life.
Thirdly, the education of wealthy Roman women was typically more comprehensive than that of Greek women. Roman women received formal education, including subjects like literature, philosophy, and sometimes even rhetoric.
Greek women, on the other hand, were primarily educated in domestic skills and rarely received formal education.
Lastly, Roman women had the opportunity to attain higher social status through marriage.
If a Roman woman married a man of high social standing, she would also gain a higher social status, something that was not possible for Greek women, as their social status remained tied to their birth family.
In summary, wealthy Roman women generally enjoyed greater legal, economic, and social independence, more involvement in public life, better education,
and opportunities to elevate their social status through marriage, compared to Greek women in the Classical Age.
To know more about Greek counterparts refer here
https://brainly.com/question/30723905#
#SPJ11
The Indian Rebellion/Mutiny began with which group of people?a. Sepoysb. Peasantsc. Noblesd. Middle class
The Indian Rebellion of 1857, also known as the Indian Mutiny, began with the group of Sepoys.
Sepoys were Indian soldiers who served in the British Indian Army. They were primarily recruited from the Hindu and Muslim populations of India and were trained and equipped by the British.
The rebellion began in May 1857, when sepoys stationed in the town of Meerut refused to use new cartridges that were suspected to be greased with animal fat, which was against their religious beliefs.
This sparked a wider revolt among the sepoys, who were joined by various groups, including peasants, nobles, and some members of the middle class.
The rebellion was a significant challenge to British rule in India and was ultimately unsuccessful, leading to the establishment of direct British rule over India.
To know more about Sepoys refer here
https://brainly.com/question/6247924#
#SPJ11
how did the kings of ghana become wealthy? a. they mined salt from the region and sold it to neighboring regions. b. they controlled how much gold was available for trade. c. they used the trans-saharan trade route to acquire expensive ivory. d. they learned to make weapons from iron and sold them to neighboring empires.
Answer:
The answer is B. They controlled how much gold was available for trade.
Explanation:
Hope this helped!^^
How did the familiars of the Inquisition get answers from the people they questioned?
Answer questions 6, 7, and 8 below as well *
**PROVIDE CLEAR ANSWER**
WILL GIVE BRAINLIEST AS WELL
The familiars of the Inquisition get answers from the people by making their presence known, allowing locals the chance to confess their sins.
Confessions were punished with anything from a beating to a pilgrimage. Those who were suspected of heresy were made to testify.
This is the way they got answers from the people they questioned.
6. What happened to people in Spain who continued to practice Judaism?
- Jews, Muslims, and Protestants in Spain were forced into conversion, banished from Spain, or put to their end.
The Inquisition extended to further regions of Europe and the Americas. Hence, the people in Spain were treated cruelly.
7. How did Rifqa's family respond to inquisition ?
-In response to the Inquisition, Rifqa, her parents, and her brothers Nathan and Saul fled to Russia in an effort to join the three elder boys who had been residing in America.
8. You have learned about the history of Iberian Peninsula in multiple lessons. Using what you have learned, explain the major issues and the surrounding environment that created these issues. Be sure to include people, events and important dates in your explanation.
- Some major issues with Iberian peninsula are-
Iberia is one of the regions in Europe most likely to suffer severely from extreme climate change in industries that directly depend on precipitation and warmth, such agriculture and water supply.
- According to a case study, some of the issues that were highlighted were-
Water availability: By 2071-2100, it is expected that all scenarios in the Tagus River basin would result in a major decline in water availability, which will make it harder to comply with the Albufeira Convention on water sharing between Spain and Portugal.Energy accessibility: By the end of the century, hydropower generation may have decreased by 45–50%. The Segura River's water supply will be drastically reduced, and it won't be able to keep up with demand, especially under the more extreme climate change scenarios.Opportunities and threats: By changing reservoir management, implementing an environmentally conscious water management strategy, and significantly reducing the amount of water supplied to the Segura River transfer.Some major events that affected Iberia-
A Germanic invasion of the Iberian Peninsula in 406 included the Vandals, Swabians, and Alans, an Iranian-born non-Germanic group who had joined the Vandals. The invaders reached the west coast in less than two years.Iberia's history was dominated by Muslim rule from the early eighth century until the late fifteenth century, despite Christian attempts to retake governmental control of the peninsula. Early Portuguese growth was fueled by a stable monarchy by the fifteenth century. The union of Isabel and Fernando in Spain in 1479 was a crucial turning point in the creation of modern Spain. The contemporary states of Spain and Portugal are a result of those events. The first European state was Portugal.To know more about The Inquisition visit:
https://brainly.com/question/22445626
#SPJ1
What changes to the legal system did Alexander III make?
Alexander III made several changes to the legal system in Russia. One of the most significant changes was the creation of a new court system, which included district and circuit courts, as well as a court of cassation.
He also introduced a new law code, which aimed to clarify and simplify the legal system, and established new rules for trials and appeals.
Additionally, he increased the power of the police and secret police, giving them greater authority to suppress political dissent and maintain order. These changes helped to centralize and strengthen the legal system in Russia, but also contributed to the growth of authoritarianism and the suppression of civil liberties.
To know more about Alexander III,refers to the link:
https://brainly.com/question/1833055#
#SPJ11
In two sentences, explain why people support and oppose new voting rules that some state legislatures have made in the United States.
Thank you!! :)
Could Nietzsche be considered the philosopher of the “romantic hero”? If so, how so?
Friedrich Nietzsche was a German philosopher who was associated with the Romantic movement.
Nietzsche's importance as an irrationalist philosopher lay in that, while his early influences are to be found in Romanticism, he founded a modern irrationalism antithetical to that of the Romantics.
The works of Nietzsche can be divided into three distinct time periods. The Romantic worldview, influenced by Schopenhauer and Wagner, predominates in the early works.
Nietzsche frequently came to be identified with the Romantic movement in his later attempts to "cure himself" of all romanticism.
Yet, because of Nietzsche's own efforts to reveal romanticism's weaknesses, which became one of his main critical purposes beginning with his aphoristic phase, the less significant but more intriguing topic of whether he is a romantic has eclipsed the issue of his relationship to romanticism.
To know more about Nietzsche,
brainly.com/question/31227973
When did cotton become a major export from America?
The combination of the invention of the cotton gin, the profitability of cotton, and the expansion of slavery in the southern states all contributed to the rise of cotton as a major export from America in the 19th century.
Cotton became a major export from America in the 19th century, particularly after the invention of the cotton gin in 1793 by Eli Whitney. The cotton gin made it much easier and faster to separate cotton fibers from their seeds, increasing the efficiency of cotton production and lowering its cost.
By the mid-19th century, the United States had become the world's largest producer and exporter of cotton, with the vast majority of the crop grown in the southern states. Cotton was in high demand, both domestically and internationally, and it played a significant role in the economy of the southern states.
Learn more about The cotton gin here:
https://brainly.com/question/8433181
#SPJ4
They made farmers devote valuable land to cash crops like cotton and tried to compile subsistence farmers to modernize by charging them taxes What are the cons of colonial powers?
The cons of colonial powers include exploiting native resources, forcing cash crops on farmers, imposing taxes, subjugating the local population, erasing native culture and identity, and creating a legacy of inequality and instability.
Colonial powers often saw their colonies as sources of raw materials and labor to fuel their own economies. This resulted in the exploitation of native resources and people, with little regard for their welfare. Colonial powers also forced farmers to grow cash crops like cotton, which depleted the soil and reduced food security.
Furthermore, colonial powers imposed taxes on the local population, which often led to economic hardships and social unrest. The imposition of taxes was often part of an effort to modernize the local population and create a more efficient system of governance.
Finally, colonial powers eroded native culture and identity through policies of assimilation and cultural domination. This created a legacy of inequality and instability that still affects many former colonies today.
Learn More about colonial powers :
https://brainly.com/question/14447948
#SPJ4
Why do you think the Quakers and others on the Underground Railroad provide shelter to the runaways?
A. They help for humanitarian and religious reasons.
B. They are Northerners who are against Southerners.
C. They like Harriet Tubman.
D. They wanted to gain political advantage in the North.
The Quakers and others on the Underground Railroad provided shelter to runaway slaves for (Option A) humanitarian and religious reasons, not for political gain or personal preferences.
The Quakers, a religious group that believed in the equality of all human beings, felt that it was their moral duty to help those who were oppressed and suffering.
Additionally, the Underground Railroad was not a political organization, but a network of people who were dedicated to helping slaves escape to freedom.
Those who participated in the Underground Railroad did so at great personal risk, as it was illegal to aid runaway slaves. Therefore, it is unlikely that they would have risked their safety for political gain or personal preferences.
Furthermore, the Underground Railroad was not solely operated by Northerners who were against Southerners. It was a network of people who shared a common goal of helping slaves escape to freedom.
While there were certainly individuals in the North who were against slavery and supported the abolitionist movement, the Underground Railroad was made up of people from all walks of life and from various regions of the country.
In conclusion, the Quakers and others on the Underground Railroad provided shelter to runaway slaves out of a sense of (Option A) humanitarianism and religious duty, not for political gain or personal preferences.
They believed in the equality of all human beings and were willing to risk their own safety to help those who were oppressed and suffering.
For more question on "Quakers" :
https://brainly.com/question/23938089
#SPJ11
TRUE OR FALSE : the Paleozoic Era is longer than the Neoproterozoic Era.
TRUE. The Paleozoic Era, which lasted from approximately 541 million years ago to 252 million years ago, is longer than the Neoproterozoic Era, which lasted from approximately 1 billion years ago to 541 million years ago.
The earliest of the three (3) geologic eras that made up the Phanerozoic era is referred to as the Paleozoic era.
Because it began 541 million years ago and concluded 252 million years ago, the Paleozoic era is widely regarded as the Phanerozoic era's longest geologic era. The Paleozoic era is divided into six geologic periods, which are given below in order of oldest to youngest:
between the beginning and conclusion of the Paleozoic era, the following events occurred;
Marine living organisms (phyla) were present throughout the Cambrian period of the Paleozoic era.There was volcanic activity during the Paleozoic era.Finally, the Paleozoic epoch was a time in geologic history when marine fossils were subject to erosion and deposition.Learn more about Paleozoic Era here
https://brainly.com/question/11614266
#SPJ11
11. Leo III left a lasting legacy on the Byzantine religion what was it?
One of Leo III's most significant legacies was his role in the Iconoclastic Controversy, which was a period of intense debate over use of religious icons in Byzantine worship.
What was the Iconoclastic Controversy?The Iconoclastic Controversy was a conflict in the Byzantine Empire during the 8th and 9th centuries over the use of religious images, or icons. Iconoclasts, who were opposed to the use of icons, argued that they were idolatrous and violated the commandment against graven images. Iconophiles, who supported the use of icons, believed that they were necessary for religious devotion and were not themselves objects of worship. The controversy resulted in the destruction of many icons and led to the deposition of several emperors who supported iconoclasm. Eventually, iconoclasm was rejected, and the veneration of icons became a central feature of Orthodox Christianity. The controversy also contributed to the schism between the Eastern and Western churches in 1054.
To learn more about Iconoclastic Controversy, visit:
https://brainly.com/question/1741604
#SPJ1
Safety net programs include…
The Harappan Civilization was the first to build with what material?
Answer:
Harappan objects were made of stone, Shell, and metal. Copper and bronze were used to make tools, weapons, ornaments, and vessels. Gold and silver were used to make ornaments and vessels. Harappans also made stone seals.
37) The border between Germany and Poland established after World War II
The border between Germany and Poland established after World War II, known as the Oder-Neisse Line, was an outcome of the Potsdam Conference held in 1945.
The conference was attended by the leaders of the Allied Powers, including the United States, the United Kingdom, and the Soviet Union, to determine the future of Germany and its territories.
At the Potsdam Conference, it was decided that Germany would be divided into four occupation zones, and its eastern territories would be ceded to Poland and the Soviet Union. The Oder-Neisse Line, named after the two rivers Oder (Odra) and Neisse (Nysa), was proposed as the new border between Germany and Poland. This border shift aimed to compensate Poland for its territorial losses to the Soviet Union in the east.
The Oder-Neisse Line was a contentious issue, as it resulted in the displacement of millions of Germans living in the territories given to Poland. The new border was initially a provisional one, and it wasn't until the 1970 Treaty of Warsaw between West Germany and Poland that it was officially recognized. Finally, with the reunification of Germany in 1990, the border was confirmed as permanent in the German-Polish Border Treaty.
In summary, the Oder-Neisse Line established the border between Germany and Poland after World War II, following the decisions made at the Potsdam Conference. It remains the border between the two countries to this day, after being officially recognized in multiple treaties.
For more about World War II:
https://brainly.com/question/13382356
#SPJ11
All soon gained nuclear weapons that threatened to begin regional arms races. But a solid agreement between the two main Cold War protagonists limiting the stockpiles of nuclear weapons proved very difficult to find. President Eisenhower, in 1955, had urged an agreement on 'open skies'.
Two effects of the arms race between the United States and the USSR were: increased military spending and heightened tensions between the two superpowers.
During the Cold War, both the US and the USSR engaged in an arms race to develop and build up their military capabilities, including nuclear weapons. This led to a significant increase in military spending, as both sides invested heavily in new weapons technology, research and development, and military infrastructure.
The arms race contributed to a significant drain on resources and funding, as governments devoted large portions of their budgets to the military rather than other areas such as education or healthcare.
In addition, the arms race also led to heightened tensions between the US and the USSR. The two superpowers engaged in a competitive struggle for power and influence, with each side seeking to outdo the other in military might.
This led to a series of proxy wars, such as the Korean War and the Vietnam War, as well as a number of diplomatic crises, including the Cuban Missile Crisis. The arms race ultimately contributed to a period of heightened global instability, with the threat of nuclear war looming large over the international community.
To know more about USSR, refer here:
https://brainly.com/question/30281523#
#SPJ11
Complete question:
Identify at least two effects of the arms race between the United States and the USSR.